circad | circRNAs associated with diseases

hsa_circ_0007534
Gene	DDX42	Organism	Human
Genome Locus	chr17:61869771-61877977:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29593432
Experimental Method
Sample Type	Tissues and U251, U118, LN229, and U87MG Cell lines	Comparison	Three pairs of breast cancer and corresponding adjacent non-cancerous tissues and Six breast cancer cell lines (HS-578T, T47D, MCF-7, BT549, MDA-MB-231, and SKBR-3)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGACGGAAATCCAATTGCACC Reverse ATGGAATTGCTGGCGAGTTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhou, J, Zhang, WW, Peng, F, Sun, JY, He, ZY, Wu, SG (2018). Downregulation of hsa_circ_0011946 suppresses the migration and invasion of the breast cancer cell line MCF-7 by targeting RFC3. Cancer Manag Res, 10:535-544.